Người viết  : Phạm Khang

============================Caphe=======================

Phần Giới Thiệu

Kỹ thuật sinh học (Biotechnology) là một môn học có tầm rất quan trọng trong lãnh vực nông nghiệp ngày nay. Tai Đaị Học Nông Lâm, tp HCM, môn học này đã trở thành một Phân Khoa chuyên ngành nhằm đào tạo các kỹ sư chuyên môn. Đây là một ngành mới khoảng hơn 10 năm lại đây.Bài này được soạn ra với sự cố gắng của người viết, làm cô đọng lại và đủ chuyên môn giải thích. Hơn nữa vấn để dịch thuật từ chuyên môn cũng là một khó khăn không nhỏ. Mong các bạn đọc góp ý và hiệu đính thêm.

 

===========================Caphe=Caphe=Caphe======================

 

Xâm nhập mặn, hạn hán, lũ lut, thiếu nước ngọt vào mùa khô là những tác động trưc tiếp của biến đổi khí hậu đến hai hệ thống canh tác lúa chính Đồng Bằng Sông Cửu Long (DBSCL): hệ thống lúa tôm và hệ thống chuyên canh lúa. Hệ thống lúa-tôm thường xuyên đối mắt với nguy cơ mất thu hoạch năng xuất thấp đó thiếu giống có khả năng chịu mặn cao, chống chịu sâu bệnh, đổ ngă, hạn hán và trình độ canh tác cũa người dân yếu. Hệ thống chuyên canh lúa thường xuyên đối mặt với nguy cơ sâu bệnh tăng, ngập úng trong mùa mưa và thiếu nước ngọt vào mùa khô. Những tác động này đang đưa người trồng lúa DBSCL phải đối mặt với nguy cơ mất dần diện tích trồng lúa, mất mùa, và giảm san lưong lúa. Thêm vào đó, biến động của thị trường và giá cả thấp, thất thưởng đã thực sự làm cho sinh kế của người dân trồng lúa vùng này đang bị lao đao. Trong bối cảnh này, áp dụng những đổi mới kỹ thuật và tổ chức phù vào các hệ thống canh tác lúa hiện nay là cấp thiết.

Lúa là một trong những cây lương thực quan trọng nhất ở Việt Nam và là một loại cây trồng nhạy cảm với mặn (salinity). Các vùng đất canh tác lúa ven biển hiện nay cũng rất dễ bị mặn xâm nhập khi mực nước biển dâng cao do biến đổi khí hậu. Việc tạo ra các giống lúa chịu mặn là việc làm cấp thiết nhằm đảm bảo an ninh lương thực cho đồng bằng sông Cửu Long (ĐBSCL) và Việt Nam.

Trong nhiều năm qua, các nhà khoa học đã cố gắng cải tiến nhiều giống lúa có tính chống chịu mặn và đã thành công bước đầu (Lang, 2000). Chọn giống nhờ dấu phân tử (marker) liên kết với tính trạng mục tiêu (marker assisted selection – MAS) là một phương pháp cho kết quả chọn lọc giống nhanh và chính xác. Do đó, việc thu thập, tuyển chọn được giống lúa chịu mặn từ các giống đang được trồng ở các vùng có đất ngập mặn của ĐBSCL làm vật liệu cơ sở cho lai tạo và chọn giống lúa chịu mặn là hết sức quan trọng trong tình hình hiện nay. Đề tài nghiên cứu đã thực hiện sưu tập chọn lọc 244 mẫu giống lúa để thực hiện việc đánh giá và tuyển chọn các giống lúa chống chịu mặn cho ĐBSCL.

CapheCapheCapheCapheCapheCapheCapheCapheCapheCapheCapheCaphe

 

Ứng-Dụng Kỹ-Thuật Đánh Dấu Sinh-Học Phân-Tử (Marker Assisted Selection- MAS)
Chọn Lọc Giống Lúa Có Khả Năng Chống & Chịu Mặn (Salinity Tolerance)

 

by Khang Pham (72 KNN)

 

Kỹ thuật di truyền thực vật là sự chuyển một đoạn DNA lạ, thường là một gene có chức năng mã hoá cho một thông tin hay đặc điểm có lợi nhất định vào tế bào thực vật như khả năng kháng sâu hại, kháng virus hay kháng thuốc trừ cỏ, hoặc tính chống nước mặn . Cây tái sinh từ tế bào chuyển nạp có gene lạ được lồng vào genome, biểu hiện ra kiểu hình va di truyền ổn định được gọi là cây chuyển gene. Gene lạ có thể có nguồn gốc từ vi sinh vật thực vật, động vật, thậm chí gene tổng hợp.Quá trình chuyển gene bao gồm nhiều bước:1. Xác định và phân lập gene có ích,
2. Nhân gene,
3. Chuyển gene vào tế bào thực vật,
4. Tái sinh tế bào chuyển nạp thành cây hoàn chỉnh, và
5. Đánh giá sự biểu hiện của gene.

 

[Image: Hinh%201.jpg?m=1461783010]

 

Cấu tạo phân tử DNA

 

[Image: Hinh%202.jpg?m=1461783071]

 

Tiến hành khảo sát các dấu phân tử liên quan đến khả năng chịu mặn như RM8094, RM10745, RM206, RM223 đối với các giống chuẩn chống chịu (Pokkali) và chuẩn nhiễm (IR28) để xác định các dấu phân tử phù hợp cho việc xác định giống mang gen chống chịu mặn. Phương pháp ly trích DNA của 200 giống lúa theo quy trình của Roger (1988).

 

[Image: Special1.jpg?m=1461783607]

 

[Image: Genegun.jpg?m=1461872359]
Máy Xử Dụng Súng Bắn Dì Tử (Particle Bombardment Machine)

 

Bảng 1: Trình tự các mồi dùng thí nghiệm
________________________________________________________
Marker Trình tự NST Tác giả
________________________________________________________
RM8094 For 5’ AAGTTTGTACACATCGTATACA 3’
Rev 5’CGCGACCAGTACTACTACTA 3’ 1 Nejad et al.,2008
________________________________________________________
RM10745 For 5’TGACGAATTGACACACCGAGTACG 3’
Rev 5’ ACTTCACCGTCGGCAACATGG 3’ 1 Nejad et al., 2008
________________________________________________________RM206 For 5’ CCC ATG CGT TTA ACT ATT CT 3’
Rev 5’ CGT TCC ATC GAT CCG TAT GG 3’ 8 Chen et al.,1997
________________________________________________________RM223 For 5’ AGT GAG CTT GGG CTG AAA C 3’
Rev 5’ GAA GGC AAG TCT TGG CAC TG 3’ 11 Rahman et al., 2010
________________________________________________________

 

Kết quả đánh giá tính chống chịu mặn trong môi trường dinh dưỡng của 244 mẫu giống lúa cho thấy số giống chống chịu tốt (kháng) là rất ít: 24 giống ở nồng độ mặn 4‰ (chiếm 10%) và 16 giống chống chịu ở nồng độ mặn 6‰ (chiếm 7%). Số giống chống chịu được mặn ở mức trung bình là khá nhiều (100 giống ở nồng độ mặn 4‰ và 34 giống ở nồng độ mặn 6‰). Các giống lúa chống chịu mặn tốt trong thí nghiệm ở 4‰ là MTL430, MTL442, MTL451, MTL454, MTL461, MTL462, MTL463, MTL455, MTL458, MTL504, MTL508, MTL664, MTL693, CL8, DH2, DH3, OM6976, Bông dửa đục, Một bụi đỏ, ST20 và Pokkali; và ở 6‰ là các giống MTL421, MTL506, MTL507, MTL519, MTL653, MTL702, DH4, DH5, OM1348, OM6677, Ba Cô, Bông dửa đục và Pokkali (Lê Xuân Thái 2011; Trần Nhân Dũng, 2012).Kết quả sử dụng các dấu phân tử để xác định giống lúa mang gen chịu mặn cho thấy các dấu phân tử RM8094, RM10745, RM223 không có biểu hiện dấu khác biệt giữa giống chuẩn kháng Pokkali và giống chuẩn nhiễm IR28 trên băng. Theo Rahman (2010) cho biết dấu phân tử RM223 chỉ thị đặc tính chống chịu mặn trên một số giống lúa ngắn ngày cải tiến; tuy nhiên, kết quả phân tích 224 giống lúa khảo sát chưa tìm ra được liên hệ giữa dấu phân tử này và giống kháng. Dấu phân tử RM206 cho thấy có sự khác biệt rõ rệt giữa giống chuẩn kháng và chuẩn nhiễm thể hiện trên băng.Sử dụng dấu phân tử RM206 phân tích 200 mẫu giống lúa chọn lọc cùng với giống chuẩn kháng Pokkali cho thấy có 48 giống mang chỉ dấu phân tử RM206, trong đó có 26 giống có tính chống chịu từ trung bình đến tốt với mặn ở nồng độ 4‰ (Bảng 5). Các giống lúa chống chịu mặn tốt và mang chỉ dấu phân tử RM206 là MTL461, MTL463, MTL504, MTL664, DH2, DH4, DH5, OM1348, OM6677, OM6976, CL8, ST20, Một bụi đỏ và Pokkali (Trần Nhân Dũng, 2012).

 

Bảng 5: Các giống lúa chống chịu mặn mang dấu phân tử RM206
________________________________________________________
STT Tên giống Chống chịu mặn Dấu RM206
________________________________________________________1 CL8 Kháng tốt +
2 DH2 Kháng tốt +
3 DH4 Kháng tốt +
4 DH5 Kháng tốt +
5 Một bụi đỏ Kháng tốt +
6 MTL461 Kháng tốt +
7 MTL463 Kháng tốt +
8 MTL504 Kháng tốt +
9 MTL664 Kháng tốt +
10 OM1348 Kháng tốt +
11 OM6677 Kháng tốt +
12 OM6976 Kháng tốt +
13 Pokali Kháng tốt +
14 ST20 Kháng tốt +
15 CU LU 2 Kháng trung bình +
16 MOT BUI BO DIA 1 Kháng trung bình +
17 MTL307 Kháng trung bình +
18 MTL314 Kháng trung bình +
19 MTL320 Kháng trung bình +
20 MTL384 Kháng trung bình +
21 MTL449 Kháng trung bình +
22 MTL605 Kháng trung bình +
23 MTL702 Kháng trung bình +
24 MUOI LUYEN Kháng trung bình +
25 NAM VANG 1 Kháng trung bình +
26 NANG QUOT DIEM Kháng trung bình +
27 Tét hành lùn Kháng trung bình +
_______________________________________________________

 

[Image: Photo3.jpg?m=1461784915]

 

Điện di PCR với dấu phân tử RM206

 

[Image: Photo4.jpg?m=1461784703]

 

Điện di PCR với dấu phân tử RM233

 

[Image: Hinh%205%20%281%29.png?m=1461872277]

 

Kết quả thanh lọc và điện di với dấu phân tử RM206 đã tìm được 13 giống lúa có khả năng chống chịu mặn ở mức độ từ 4‰ đến 6‰ (MTL461, MTL463, MTL504, MTL664, CL8, DH2, OM6976; OM1348, OM6677, Một bụi đỏ, ST20, DH4, DH5).Kết quả năng suất khảo nghiệm và đánh giá tổng hợp các đặc tính nông học, tính chống chịu cho thấy các giống lúa triển vọng có thể sản xuất trong vùng canh tác lúa tôm, chống chịu mặn là MTL653, MTL664, MTL691, MTL695, MTL702; hai giống lúa MTL664 và MTL702 có liên kết chặt với gen kháng mặn qua dấu phân tử RM206, thể hiện tốt ở cả hai thí nghiệm thanh lọc – xác định dấu phân tử kháng mặn và đánh giá năng suất trên ruộng bị ảnh hưởng mặn.Biến đổi khí hậu toàn cầu là chuyện của đất trời . Chúng ta không thể thay đổi một sớm một chiều ngay được, việc cần phải làm ngay là – tạo điều kiện tốt cho người nông dân vùng ngập mặn có thể có những giống lúa tốt có khả năng chịu đựng được nước ngập mặn. Hội nhập kỹ thuật tân tiến và quản lý điều hành một cách khoa học là điều duy nhất cần phải làm để tiếp tục phát triển nền nông nghiệp nước nhà.
Phạm khang

======================================

TÀI LIỆU THAM KHẢO

1. Dien Nguyen Ngoc. 2010. Selection for salt tolerance of local traditional rice varieties in mekong delta by ses (standard evaluation system) and ssr (simple sequence repeats)
markers. Summary bachelor of science thesis the advanced program in biotechnology.
2. Chen XS, Temnykh Yxu ChoYG, McCouch SR (1997). Development microsatellite framwork map providing genome wide coverage in rice (Oryza sativa.L). Theor. Appl. Genet. 95: 553-567.
3. Gregorio GB, Senadhira D, Mendoza RD (1997). Screening rice for salinity tolerance, IRRI Discussion paper Series No.22. International Rice Research Institute, Los Baños. Laguna, Philippines.
4. IRRI. 1976. Laboratory manual for physiological studies of rice. International Rice Research Institute, Los Baños. Laguna, Philippines